Method of the bovinne steroyl-CoA desaturase expression detection

VÚŽV, v.v.i., Praha. Způsob detekce exprese bovinní stearoyl-CoA-desaturázy. Původce vynálezu: KOTT, T., BARTOŇ, L. & KYSELOVÁ, J. CZ. Patentový spis CZ 301656 B6. (2010)
VÝZKUMNÝ ÚSTAV ŽIVOČIŠNÉ VÝROBY, v.v.i. V UHŘÍNĚVSI. Method of the bovinne steroyl-CoA desaturase expression detection. Authors: KOTT, Tomáš, BARTOŇ, Luděk and KYSELOVÁ, Jitka.. Česká republika. Patentový spis CZ 301656 B6. 0000-00-00.
Year2010
CathegoryPatents
Internal link10055.pdf
Abstract

Method of the bovinne steroyl-CoA desaturase expression detection using new primers and probe :Forward Primer CCGACGTGGCTTTTTCTTCT, Reverse Primer TGGGTGTTTGCGCACAAG, TaqMan MGB probe TCACGTGGGTTGGCT.